Transcript: Mouse NM_172619.4

Mus musculus a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 10 (Adamts10), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-04-23
Taxon:
Mus musculus (mouse)
Gene:
Adamts10 (224697)
Length:
4176
CDS:
274..3588

Additional Resources:

NCBI RefSeq record:
NM_172619.4
NBCI Gene record:
Adamts10 (224697)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172619.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000374430 CAAATCGCGTCAGTGTAAATA pLKO_005 1728 CDS 100% 15.000 21.000 N Adamts10 n/a
2 TRCN0000419865 CAAATCGCGTCAGTGTAAATA pLKO_005 1728 CDS 100% 15.000 21.000 N ADAMTS10 n/a
3 TRCN0000312890 AGATGCAGTTGAAAGTTATTT pLKO_005 3680 3UTR 100% 15.000 10.500 N Adamts10 n/a
4 TRCN0000374409 CCATCTACTATGCGATGTAAC pLKO_005 3247 CDS 100% 10.800 7.560 N Adamts10 n/a
5 TRCN0000032248 GCAGTATGTGTTGGCCATCAT pLKO.1 1056 CDS 100% 4.950 3.465 N Adamts10 n/a
6 TRCN0000311983 GCAGTATGTGTTGGCCATCAT pLKO_005 1056 CDS 100% 4.950 3.465 N Adamts10 n/a
7 TRCN0000032245 CCCATGTAGTATACAAGCGTT pLKO.1 800 CDS 100% 2.640 1.848 N Adamts10 n/a
8 TRCN0000032247 CTCACATTCAAGGTCACGCAT pLKO.1 325 CDS 100% 2.640 1.848 N Adamts10 n/a
9 TRCN0000032246 GCTATGAGATTGCCTTCCCAA pLKO.1 386 CDS 100% 2.640 1.848 N Adamts10 n/a
10 TRCN0000050330 GACAAGATGATGGTGGCCTAT pLKO.1 1015 CDS 100% 4.050 2.835 N ADAMTS10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172619.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.