Transcript: Mouse NM_172666.3

Mus musculus alkylglycerone phosphate synthase (Agps), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Agps (228061)
Length:
7375
CDS:
37..2052

Additional Resources:

NCBI RefSeq record:
NM_172666.3
NBCI Gene record:
Agps (228061)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172666.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435550 AGCACAAGGCTGCCCATTATC pLKO_005 2297 3UTR 100% 13.200 18.480 N Agps n/a
2 TRCN0000428470 GTCATTGTCTTCACGAGATAT pLKO_005 638 CDS 100% 13.200 18.480 N Agps n/a
3 TRCN0000076115 CCTCCTTCTATTGTGAATGAA pLKO.1 541 CDS 100% 5.625 4.500 N Agps n/a
4 TRCN0000076113 GCAGATAATCTAGCAAAGATT pLKO.1 2439 3UTR 100% 0.563 0.450 N Agps n/a
5 TRCN0000076117 GCTGACTTATGTCATTGCATA pLKO.1 1593 CDS 100% 4.950 3.465 N Agps n/a
6 TRCN0000076116 GCTGGGATAACAGGACAAGAT pLKO.1 913 CDS 100% 4.950 3.465 N Agps n/a
7 TRCN0000076114 CCCAAGTAACATCTTTGGAAA pLKO.1 2016 CDS 100% 4.950 2.970 N Agps n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172666.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.