Transcript: Mouse NM_172668.3

Mus musculus low density lipoprotein receptor-related protein 4 (Lrp4), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-25
Taxon:
Mus musculus (mouse)
Gene:
Lrp4 (228357)
Length:
8028
CDS:
171..5888

Additional Resources:

NCBI RefSeq record:
NM_172668.3
NBCI Gene record:
Lrp4 (228357)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172668.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000119633 CGGGCCATTGTATTATACCAT pLKO.1 3678 CDS 100% 3.000 4.200 N Lrp4 n/a
2 TRCN0000119635 CGTGCCAGGATGTAAACGAAT pLKO.1 1345 CDS 100% 4.950 3.960 N Lrp4 n/a
3 TRCN0000119636 GCCGGCATGAAGACTATTGAA pLKO.1 2934 CDS 100% 5.625 3.938 N Lrp4 n/a
4 TRCN0000119634 CCACCACCTTACATTCTTCTA pLKO.1 5197 CDS 100% 4.950 3.465 N Lrp4 n/a
5 TRCN0000053311 CCAGGAAATCATTCGCAACAA pLKO.1 2189 CDS 100% 4.950 3.465 N LRP4 n/a
6 TRCN0000119632 CCCTAGAATCTCATCCCAGTT pLKO.1 7160 3UTR 100% 4.050 2.430 N Lrp4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172668.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.