Transcript: Mouse NM_172689.3

Mus musculus DEAD (Asp-Glu-Ala-Asp) box polypeptide 58 (Ddx58), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Ddx58 (230073)
Length:
4943
CDS:
130..2910

Additional Resources:

NCBI RefSeq record:
NM_172689.3
NBCI Gene record:
Ddx58 (230073)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172689.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000378444 ACTGGAACAGGTCGTTTATAA pLKO_005 1476 CDS 100% 15.000 21.000 N Ddx58 n/a
2 TRCN0000362858 CGGACTTCGAACACGTTTAAA pLKO_005 1528 CDS 100% 15.000 21.000 N Ddx58 n/a
3 TRCN0000103886 CCACAGTTGATCCAAATGATA pLKO.1 476 CDS 100% 5.625 7.875 N Ddx58 n/a
4 TRCN0000103885 GCAAAGATATTCTGCGCCAAA pLKO.1 2710 CDS 100% 4.050 5.670 N Ddx58 n/a
5 TRCN0000363411 CAAGCATTCAGAGACTATATC pLKO_005 157 CDS 100% 13.200 10.560 N Ddx58 n/a
6 TRCN0000103888 GCCATGCAACATATCTGTAAA pLKO.1 1399 CDS 100% 13.200 9.240 N Ddx58 n/a
7 TRCN0000103889 GCAATGAGAATCCTAAACTAA pLKO.1 1946 CDS 100% 5.625 3.938 N Ddx58 n/a
8 TRCN0000103887 CGCTAACCAAATTCCTGTCTA pLKO.1 1020 CDS 100% 4.950 3.465 N Ddx58 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172689.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.