Transcript: Mouse NM_172709.3

Mus musculus otopetrin 1 (Otop1), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Otop1 (21906)
Length:
3171
CDS:
25..1827

Additional Resources:

NCBI RefSeq record:
NM_172709.3
NBCI Gene record:
Otop1 (21906)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172709.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000216698 CATCACGTTGTTCGCGTTTAT pLKO.1 426 CDS 100% 13.200 18.480 N Otop1 n/a
2 TRCN0000246621 CATCACGTTGTTCGCGTTTAT pLKO_005 426 CDS 100% 13.200 18.480 N Otop1 n/a
3 TRCN0000246618 CCATGCAGTGCATACCCTATT pLKO_005 534 CDS 100% 10.800 15.120 N Otop1 n/a
4 TRCN0000246620 GTGCGTTCTAACCGCGCTTAT pLKO_005 297 CDS 100% 10.800 15.120 N Otop1 n/a
5 TRCN0000194325 CGGCTCTCATCATGTTCTATT pLKO.1 1052 CDS 100% 13.200 9.240 N Otop1 n/a
6 TRCN0000246622 TGCCCTCTTTGAGGTCTATTG pLKO_005 1797 CDS 100% 10.800 7.560 N Otop1 n/a
7 TRCN0000246619 TGCGAAAGCCAAGCGTGTTTC pLKO_005 2800 3UTR 100% 10.800 7.560 N Otop1 n/a
8 TRCN0000173651 CCCTCTTTGAGGTCTATTGTA pLKO.1 1799 CDS 100% 5.625 3.938 N Otop1 n/a
9 TRCN0000175800 GCTGTCAGAATCTCAAACTAA pLKO.1 2707 3UTR 100% 5.625 3.938 N Otop1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172709.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.