Transcript: Mouse NM_172713.2

Mus musculus SDA1 domain containing 1 (Sdad1), mRNA.

Source:
NCBI, updated 2017-06-11
Taxon:
Mus musculus (mouse)
Gene:
Sdad1 (231452)
Length:
5020
CDS:
144..2207

Additional Resources:

NCBI RefSeq record:
NM_172713.2
NBCI Gene record:
Sdad1 (231452)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172713.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000247855 CAGTGTACATGTAGGTAATTA pLKO_005 4818 3UTR 100% 15.000 10.500 N Sdad1 n/a
2 TRCN0000247856 GAAGTAACTTATCAGCAAATT pLKO_005 2201 CDS 100% 13.200 9.240 N Sdad1 n/a
3 TRCN0000247857 ACTTTATGATGATGCGGTATA pLKO_005 2092 CDS 100% 10.800 7.560 N Sdad1 n/a
4 TRCN0000215993 CTTTATGATGATGCGGTATAG pLKO.1 2093 CDS 100% 10.800 7.560 N Sdad1 n/a
5 TRCN0000247859 TGCTGTCTCTTCGGGACATTG pLKO_005 1921 CDS 100% 10.800 7.560 N Sdad1 n/a
6 TRCN0000247858 TTTCAGCTATTCACTTGATTC pLKO_005 994 CDS 100% 10.800 7.560 N Sdad1 n/a
7 TRCN0000200563 CCTTCAGCAATATAACCACTA pLKO.1 236 CDS 100% 4.050 2.835 N Sdad1 n/a
8 TRCN0000192079 CCAAGATATTGGTTGCTGCTT pLKO.1 775 CDS 100% 2.640 1.848 N Sdad1 n/a
9 TRCN0000201090 CCCAGAGATTATTCAGTCGTT pLKO.1 1241 CDS 100% 2.640 1.848 N Sdad1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172713.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.