Transcript: Mouse NM_172721.2

Mus musculus F-box and WD-40 domain protein 8 (Fbxw8), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Fbxw8 (231672)
Length:
4978
CDS:
78..1874

Additional Resources:

NCBI RefSeq record:
NM_172721.2
NBCI Gene record:
Fbxw8 (231672)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172721.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000012731 GCTGGTTGACTACCTTGAAAT pLKO.1 1106 CDS 100% 13.200 18.480 N Fbxw8 n/a
2 TRCN0000280141 GCTGGTTGACTACCTTGAAAT pLKO_005 1106 CDS 100% 13.200 18.480 N Fbxw8 n/a
3 TRCN0000012729 GCCATCAATATATTCCAGTAT pLKO.1 447 CDS 100% 4.950 6.930 N Fbxw8 n/a
4 TRCN0000280142 GCCATCAATATATTCCAGTAT pLKO_005 447 CDS 100% 4.950 6.930 N Fbxw8 n/a
5 TRCN0000012730 CCACAGCAGATTCTCCGATTA pLKO.1 578 CDS 100% 10.800 7.560 N Fbxw8 n/a
6 TRCN0000280194 CCACAGCAGATTCTCCGATTA pLKO_005 578 CDS 100% 10.800 7.560 N Fbxw8 n/a
7 TRCN0000012732 GCCAACTGGAAGAATCGCAAA pLKO.1 654 CDS 100% 4.050 2.835 N Fbxw8 n/a
8 TRCN0000280143 GCCAACTGGAAGAATCGCAAA pLKO_005 654 CDS 100% 4.050 2.835 N Fbxw8 n/a
9 TRCN0000012728 GCTGGCTTAGTGTTACTGTTT pLKO.1 4086 3UTR 100% 4.950 2.970 N Fbxw8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172721.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.