Transcript: Mouse NM_172733.1

Mus musculus deoxyribose-phosphate aldolase (putative) (Dera), mRNA.

Source:
NCBI, updated 2017-06-25
Taxon:
Mus musculus (mouse)
Gene:
Dera (232449)
Length:
1688
CDS:
32..988

Additional Resources:

NCBI RefSeq record:
NM_172733.1
NBCI Gene record:
Dera (232449)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172733.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000305811 CTGAAAGCTGTCACGTTTATA pLKO_005 173 CDS 100% 15.000 21.000 N Dera n/a
2 TRCN0000103758 GACTCATTTAAAGACTCGATT pLKO.1 430 CDS 100% 4.950 6.930 N Dera n/a
3 TRCN0000324364 GACTCATTTAAAGACTCGATT pLKO_005 430 CDS 100% 4.950 6.930 N Dera n/a
4 TRCN0000103756 CGTGGTCATTAACAGGACCTT pLKO.1 496 CDS 100% 2.640 3.696 N Dera n/a
5 TRCN0000103755 CCTACCTCTGACACATAATAA pLKO.1 1467 3UTR 100% 15.000 10.500 N Dera n/a
6 TRCN0000324363 CCTACCTCTGACACATAATAA pLKO_005 1467 3UTR 100% 15.000 10.500 N Dera n/a
7 TRCN0000311415 ACAGCTGCAGTCTGCGTTTAT pLKO_005 317 CDS 100% 13.200 9.240 N Dera n/a
8 TRCN0000103757 TCAGACATCGAGAGACAGATT pLKO.1 914 CDS 100% 4.950 3.465 N Dera n/a
9 TRCN0000324432 TCAGACATCGAGAGACAGATT pLKO_005 914 CDS 100% 4.950 3.465 N Dera n/a
10 TRCN0000103759 AGACTCATTTAAAGACTCGAT pLKO.1 429 CDS 100% 2.640 1.848 N Dera n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172733.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.