Transcript: Mouse NM_172746.3

Mus musculus HIRA interacting protein 3 (Hirip3), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Hirip3 (233876)
Length:
2511
CDS:
481..2286

Additional Resources:

NCBI RefSeq record:
NM_172746.3
NBCI Gene record:
Hirip3 (233876)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172746.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000121368 GCTAGACTAAAGCGTTACATT pLKO.1 1894 CDS 100% 5.625 7.875 N Hirip3 n/a
2 TRCN0000121371 CCCGAAGTTGTTCATCTTCAT pLKO.1 1745 CDS 100% 4.950 6.930 N Hirip3 n/a
3 TRCN0000121370 GCTTTAATTCAGAGTCAGAAT pLKO.1 758 CDS 100% 4.950 6.930 N Hirip3 n/a
4 TRCN0000436895 ACCTCCAGACTGGTCCCATAT pLKO_005 2229 CDS 100% 10.800 7.560 N Hirip3 n/a
5 TRCN0000428680 CAGAAGGGCCAGGTTAGAAAG pLKO_005 1009 CDS 100% 10.800 7.560 N Hirip3 n/a
6 TRCN0000430829 GAAAGCCAGACTTTATCAAAG pLKO_005 689 CDS 100% 10.800 7.560 N Hirip3 n/a
7 TRCN0000438462 GGCTCTGTTAGATCAGGTAAG pLKO_005 955 CDS 100% 6.000 4.200 N Hirip3 n/a
8 TRCN0000121369 CCTCAACAAAGAACAGGACAA pLKO.1 815 CDS 100% 4.050 2.835 N Hirip3 n/a
9 TRCN0000415434 TGGTCAGTGGAAGCAACTTCC pLKO_005 2330 3UTR 100% 4.050 2.835 N Hirip3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172746.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.