Transcript: Mouse NM_172749.4

Mus musculus zinc finger protein 646 (Zfp646), mRNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
Zfp646 (233905)
Length:
6327
CDS:
491..5857

Additional Resources:

NCBI RefSeq record:
NM_172749.4
NBCI Gene record:
Zfp646 (233905)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172749.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000084684 GCGAGCAACCTTCTTAGCAAT pLKO.1 1073 CDS 100% 4.950 6.930 N Zfp646 n/a
2 TRCN0000084687 GCAACAGAAATGGTTGCAGAT pLKO.1 3434 CDS 100% 0.405 0.324 N Zfp646 n/a
3 TRCN0000084685 GCTCTCTCTGTCCAAAGGAAT pLKO.1 2994 CDS 100% 4.950 3.465 N Zfp646 n/a
4 TRCN0000084686 GCTTGTAGTAATTGTAGCAAA pLKO.1 5141 CDS 100% 4.950 3.465 N Zfp646 n/a
5 TRCN0000084683 CCCAAGATCCTTTGGGAGAAA pLKO.1 2574 CDS 100% 0.495 0.347 N Zfp646 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172749.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.