Transcript: Mouse NM_172777.4

Mus musculus guanylate-binding protein 9 (Gbp9), transcript variant 1, mRNA.

Source:
NCBI, updated 2018-05-24
Taxon:
Mus musculus (mouse)
Gene:
Gbp9 (236573)
Length:
5561
CDS:
113..1972

Additional Resources:

NCBI RefSeq record:
NM_172777.4
NBCI Gene record:
Gbp9 (236573)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172777.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000115037 CCATTCTGGAACTTATCGAAA pLKO.1 1872 CDS 100% 4.950 6.930 N Gbp9 n/a
2 TRCN0000115038 CTCCAGTCACAGTACATCATT pLKO.1 1490 CDS 100% 5.625 3.938 N Gbp9 n/a
3 TRCN0000115039 CACAGTACATCATTGAGAGTT pLKO.1 1497 CDS 100% 4.950 3.465 N Gbp9 n/a
4 TRCN0000115036 CCACAACAAATCCTTTCTTAA pLKO.1 2484 3UTR 100% 13.200 7.920 N Gbp9 n/a
5 TRCN0000115040 CCAGACTTTGTCTGGACTGTT pLKO.1 626 CDS 100% 0.495 0.248 Y Gbp9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172777.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.