Transcript: Mouse NM_172786.2

Mus musculus interleukin 20 receptor, alpha (Il20ra), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Il20ra (237313)
Length:
2088
CDS:
48..1688

Additional Resources:

NCBI RefSeq record:
NM_172786.2
NBCI Gene record:
Il20ra (237313)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172786.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000432825 GCCTCTAAATGCGGGAGTATC pLKO_005 306 CDS 100% 10.800 15.120 N Il20ra n/a
2 TRCN0000446995 CACGGAGTTGAAGTCACATAC pLKO_005 243 CDS 100% 10.800 8.640 N Il20ra n/a
3 TRCN0000067924 CCTGAGAACTATGGTCATTAT pLKO.1 1527 CDS 100% 13.200 9.240 N Il20ra n/a
4 TRCN0000414360 TACTGAAACAATCACACTTAA pLKO_005 965 CDS 100% 13.200 9.240 N Il20ra n/a
5 TRCN0000438608 GCGAGAAGTCCATCTCTATTG pLKO_005 496 CDS 100% 10.800 7.560 N Il20ra n/a
6 TRCN0000067926 CCTACAAATATCACCTTCTTA pLKO.1 174 CDS 100% 5.625 3.938 N Il20ra n/a
7 TRCN0000067925 CCAGCAAATTTGGTACTGATT pLKO.1 909 CDS 100% 4.950 3.465 N Il20ra n/a
8 TRCN0000067927 CCAGTTCTATGCCAAAGTGAA pLKO.1 374 CDS 100% 4.950 3.465 N Il20ra n/a
9 TRCN0000067923 GCTTTGTTGTAGACAGAGTAA pLKO.1 1895 3UTR 100% 4.950 3.465 N Il20ra n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172786.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.