Transcript: Mouse NM_172800.2

Mus musculus sidekick cell adhesion molecule 2 (Sdk2), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Sdk2 (237979)
Length:
6604
CDS:
74..6604

Additional Resources:

NCBI RefSeq record:
NM_172800.2
NBCI Gene record:
Sdk2 (237979)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172800.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000420130 CCCATCACGCGCTACGTAATA pLKO_005 5642 CDS 100% 13.200 18.480 N Sdk2 n/a
2 TRCN0000094267 CGAGATCCGAATGAGCATATA pLKO.1 4870 CDS 100% 13.200 18.480 N Sdk2 n/a
3 TRCN0000094265 CCACTCCTTTGTCAACCATTA pLKO.1 6295 CDS 100% 10.800 7.560 N Sdk2 n/a
4 TRCN0000413306 TACAGCAGGAAGACGTGAAAG pLKO_005 4308 CDS 100% 10.800 7.560 N Sdk2 n/a
5 TRCN0000094268 CCTCTCATCAAGCTGCACATT pLKO.1 812 CDS 100% 4.950 3.465 N Sdk2 n/a
6 TRCN0000094266 GCAGGCGGTTAATGACAAGAA pLKO.1 634 CDS 100% 4.950 3.465 N Sdk2 n/a
7 TRCN0000094264 GCTGTCAATGATGTGGGCAAA pLKO.1 2084 CDS 100% 4.050 2.835 N Sdk2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172800.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.