Transcript: Mouse NM_172805.3

Mus musculus potassium voltage-gated channel, subfamily H (eag-related), member 5 (Kcnh5), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Kcnh5 (238271)
Length:
4061
CDS:
805..3771

Additional Resources:

NCBI RefSeq record:
NM_172805.3
NBCI Gene record:
Kcnh5 (238271)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172805.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434241 ACATGCAAATCGCACCAATAA pLKO_005 1127 CDS 100% 13.200 18.480 N Kcnh5 n/a
2 TRCN0000019668 GCGCTCCAGTGAATCAAGTTT pLKO.1 867 CDS 100% 5.625 7.875 N KCNH5 n/a
3 TRCN0000085547 CGAGCCTTACAACCATAGGAT pLKO.1 2087 CDS 100% 3.000 4.200 N Kcnh5 n/a
4 TRCN0000433290 ACAGTGTGGTGGACGTGATTT pLKO_005 1556 CDS 100% 13.200 9.240 N Kcnh5 n/a
5 TRCN0000085545 CCCAAATACCATGTCAGGATA pLKO.1 3692 CDS 100% 4.950 3.465 N Kcnh5 n/a
6 TRCN0000085546 CGTTACCATGAGATGCTGAAT pLKO.1 2242 CDS 100% 4.950 3.465 N Kcnh5 n/a
7 TRCN0000085544 GCAGTGGAGTTCCAAACCATT pLKO.1 2491 CDS 100% 4.950 3.465 N Kcnh5 n/a
8 TRCN0000085543 GCTTTCAATATGATGAACACA pLKO.1 3870 3UTR 100% 3.000 2.100 N Kcnh5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172805.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.