Transcript: Mouse NM_172808.2

Mus musculus anthrax toxin receptor-like (Antxrl), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Antxrl (239029)
Length:
2126
CDS:
197..2122

Additional Resources:

NCBI RefSeq record:
NM_172808.2
NBCI Gene record:
Antxrl (239029)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172808.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000175166 GCAATATGAAGCAAGTCATTT pLKO.1 1041 CDS 100% 13.200 9.240 N Antxrl n/a
2 TRCN0000175189 CTTTGCATAAAGCCTAAGAAA pLKO.1 1346 CDS 100% 5.625 3.938 N Antxrl n/a
3 TRCN0000173540 GCCTACCTACGTTTGTGCAAA pLKO.1 973 CDS 100% 4.950 3.465 N Antxrl n/a
4 TRCN0000174645 GAAGAAATTCACAAACCCTAA pLKO.1 502 CDS 100% 4.050 2.835 N Antxrl n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172808.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.