Transcript: Mouse NM_172834.2

Mus musculus lipoxygenase homology domains 1 (Loxhd1), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Loxhd1 (240411)
Length:
6595
CDS:
1..6207

Additional Resources:

NCBI RefSeq record:
NM_172834.2
NBCI Gene record:
Loxhd1 (240411)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172834.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000438299 GATCTCGGCAGGTTCTATAAG pLKO_005 1444 CDS 100% 13.200 18.480 N Loxhd1 n/a
2 TRCN0000436039 AGGCAATGCCGACGAGTTTAC pLKO_005 1803 CDS 100% 10.800 15.120 N Loxhd1 n/a
3 TRCN0000430138 GGTTCAAGCCAGGCATCATTG pLKO_005 1400 CDS 100% 10.800 15.120 N Loxhd1 n/a
4 TRCN0000421530 TATATTCAGCACATCTCATAA pLKO_005 6388 3UTR 100% 13.200 10.560 N Loxhd1 n/a
5 TRCN0000437074 TGTACACTGGTGACGTGATTG pLKO_005 533 CDS 100% 10.800 8.640 N Loxhd1 n/a
6 TRCN0000437363 ATTCCGGGTGCGAACCAATAA pLKO_005 282 CDS 100% 13.200 9.240 N Loxhd1 n/a
7 TRCN0000429036 TCCGAGAACTGGTCCCTTATG pLKO_005 3665 CDS 100% 10.800 7.560 N Loxhd1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172834.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09491 pDONR223 100% 21.9% 23.8% None (many diffs) n/a
2 ccsbBroad304_09491 pLX_304 0% 21.9% 23.8% V5 (many diffs) n/a
Download CSV