Transcript: Mouse NM_172851.2

Mus musculus contactin associated protein-like 5B (Cntnap5b), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Cntnap5b (241175)
Length:
5120
CDS:
1..3879

Additional Resources:

NCBI RefSeq record:
NM_172851.2
NBCI Gene record:
Cntnap5b (241175)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172851.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000094768 GACTGGAGTGACTACTGTTTA pLKO.1 3579 CDS 100% 13.200 18.480 N Cntnap5b n/a
2 TRCN0000434667 GTCTGACAGAGAATGATATTG pLKO_005 4327 3UTR 100% 13.200 10.560 N Cntnap5b n/a
3 TRCN0000094765 CCCTATGTCATGAACTTAAAT pLKO.1 1948 CDS 100% 15.000 10.500 N Cntnap5b n/a
4 TRCN0000417457 ACAATTGTCCCTGGTCAATAT pLKO_005 4259 3UTR 100% 13.200 9.240 N Cntnap5b n/a
5 TRCN0000094766 CCAAACAGTGAGGTCACTCAT pLKO.1 3354 CDS 100% 4.950 3.465 N Cntnap5b n/a
6 TRCN0000094767 CCTTCCGAAGAGTATGAGGAT pLKO.1 2637 CDS 100% 2.640 1.848 N Cntnap5b n/a
7 TRCN0000424021 CTGAACTTGGATGATAGCAAA pLKO_005 724 CDS 100% 4.950 2.970 N Cntnap5b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172851.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.