Transcript: Mouse NM_172854.2

Mus musculus olfactomedin-like 2A (Olfml2a), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Olfml2a (241327)
Length:
2409
CDS:
98..2143

Additional Resources:

NCBI RefSeq record:
NM_172854.2
NBCI Gene record:
Olfml2a (241327)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172854.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000203188 GCAACTCTTGCAATTGATATA pLKO.1 2197 3UTR 100% 13.200 18.480 N Olfml2a n/a
2 TRCN0000339520 GTGGCCCGACAGTAAGGTATT pLKO_005 187 CDS 100% 10.800 15.120 N Olfml2a n/a
3 TRCN0000351032 AGCAACTCTTGCAATTGATAT pLKO_005 2196 3UTR 100% 13.200 10.560 N Olfml2a n/a
4 TRCN0000339519 ACAAGGCCGATGGAGTAATAT pLKO_005 1534 CDS 100% 15.000 10.500 N Olfml2a n/a
5 TRCN0000339590 ACCGTGCCTTCACCAAGAATA pLKO_005 1620 CDS 100% 13.200 9.240 N Olfml2a n/a
6 TRCN0000339591 TGGTCTGAGTGGGCATCTATG pLKO_005 2136 CDS 100% 10.800 7.560 N Olfml2a n/a
7 TRCN0000203342 CTATGTCACCAACTACTACTA pLKO.1 1471 CDS 100% 4.950 3.465 N OLFML2A n/a
8 TRCN0000187594 GACACTTACAACCAGCATGAA pLKO.1 1949 CDS 100% 4.950 3.465 N Olfml2a n/a
9 TRCN0000186926 GATCTATGTCACCAACTACTA pLKO.1 1468 CDS 100% 4.950 3.465 N OLFML2A n/a
10 TRCN0000312441 GATCTATGTCACCAACTACTA pLKO_005 1468 CDS 100% 4.950 3.465 N OLFML2A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172854.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.