Transcript: Mouse NM_172862.3

Mus musculus Fras1 related extracellular matrix protein 2 (Frem2), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Frem2 (242022)
Length:
12368
CDS:
272..9754

Additional Resources:

NCBI RefSeq record:
NM_172862.3
NBCI Gene record:
Frem2 (242022)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172862.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000077683 CGGAAATGACAAGTTGTCTAA pLKO.1 10199 3UTR 100% 4.950 6.930 N Frem2 n/a
2 TRCN0000077687 TCCTTGCTGATATACGATGAT pLKO.1 7373 CDS 100% 4.950 6.930 N Frem2 n/a
3 TRCN0000077686 GCTGGACTACAATGAAGTAAA pLKO.1 7987 CDS 100% 13.200 10.560 N Frem2 n/a
4 TRCN0000077685 CTGCTGGACTACAATGAAGTA pLKO.1 7985 CDS 100% 4.950 3.465 N Frem2 n/a
5 TRCN0000077684 CCTTTGACCTTGACATTCGAT pLKO.1 8754 CDS 100% 3.000 2.100 N Frem2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172862.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.