Transcript: Mouse NM_172885.2

Mus musculus transmembrane protein 132D (Tmem132d), mRNA.

Source:
NCBI, updated 2019-01-19
Taxon:
Mus musculus (mouse)
Gene:
Tmem132d (243274)
Length:
4278
CDS:
714..4007

Additional Resources:

NCBI RefSeq record:
NM_172885.2
NBCI Gene record:
Tmem132d (243274)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172885.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000200593 CAACCCATTTGGATTCACTAA pLKO.1 1055 CDS 100% 4.950 6.930 N Tmem132d n/a
2 TRCN0000192433 CGTCATCGTTTGTCAGAAGAA pLKO.1 1784 CDS 100% 4.950 6.930 N Tmem132d n/a
3 TRCN0000192176 CTTTCAGCCTTTAACCCACTT pLKO.1 4032 3UTR 100% 4.050 3.240 N Tmem132d n/a
4 TRCN0000201863 GCATAGAATTGGGAGCGTCTT pLKO.1 1502 CDS 100% 4.050 3.240 N Tmem132d n/a
5 TRCN0000217041 CAGCCAGCATCAAGGTTAAAT pLKO.1 3079 CDS 100% 15.000 10.500 N Tmem132d n/a
6 TRCN0000191556 GTTCTTACCTTTCAGCCTTTA pLKO.1 4024 3UTR 100% 10.800 7.560 N Tmem132d n/a
7 TRCN0000190647 CCCAGGATTTGATGTTGCCTT pLKO.1 1033 CDS 100% 2.640 1.848 N Tmem132d n/a
8 TRCN0000215522 GAGTAATGAGGATGACATTAA pLKO.1 3908 CDS 100% 1.320 0.924 N Tmem132d n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172885.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.