Transcript: Mouse NM_172887.2

Mus musculus FRY microtubule binding protein (Fry), mRNA.

Source:
NCBI, updated 2017-04-22
Taxon:
Mus musculus (mouse)
Gene:
Fry (320365)
Length:
10753
CDS:
340..9402

Additional Resources:

NCBI RefSeq record:
NM_172887.2
NBCI Gene record:
Fry (320365)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172887.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000374987 GTATAAGTGGCTCGACAATAT pLKO_005 3888 CDS 100% 13.200 18.480 N Fry n/a
2 TRCN0000374927 GGCTTCTTTGCCTGATATAAA pLKO_005 8091 CDS 100% 15.000 10.500 N Fry n/a
3 TRCN0000345485 ATGAACAGCAGCGAGACTATT pLKO_005 806 CDS 100% 13.200 9.240 N Fry n/a
4 TRCN0000345484 CTTCAGCTGCTTCGGATATTC pLKO_005 3430 CDS 100% 13.200 9.240 N Fry n/a
5 TRCN0000345414 GACATGACTTCCGTTGCATTA pLKO_005 9676 3UTR 100% 10.800 7.560 N Fry n/a
6 TRCN0000374926 GCTACCCTTCACCAAGCAAAT pLKO_005 9635 3UTR 100% 10.800 7.560 N Fry n/a
7 TRCN0000142765 CCCAATCAGTTCTGTAAGGAT pLKO.1 6838 CDS 100% 3.000 2.100 N FRY n/a
8 TRCN0000345412 ACCATCCTCCTGCCCTATATT pLKO_005 4744 CDS 100% 15.000 9.000 N Fry n/a
9 TRCN0000122800 GCGGAGACAACTATGTTACTT pLKO.1 3059 CDS 100% 5.625 7.875 N FRY n/a
10 TRCN0000362726 GGATGACACCAACAGCGAATA pLKO_005 7701 CDS 100% 10.800 5.400 Y Mapk8ip2 n/a
11 TRCN0000142067 GTTGCGGAACAAAGACCTGAT pLKO.1 4222 CDS 100% 4.050 2.835 N DIP2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172887.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.