Transcript: Mouse NM_172888.3

Mus musculus seminal vesicle secretory protein 1 (Svs1), mRNA.

Source:
NCBI, updated 2017-05-11
Taxon:
Mus musculus (mouse)
Gene:
Svs1 (243377)
Length:
2778
CDS:
200..2662

Additional Resources:

NCBI RefSeq record:
NM_172888.3
NBCI Gene record:
Svs1 (243377)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172888.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000120034 CGGTAGCCTTTACAACCAGAA pLKO.1 2404 CDS 100% 4.050 5.670 N Svs1 n/a
2 TRCN0000120033 GCCCGTGTTCTGATCTACTTT pLKO.1 503 CDS 100% 5.625 4.500 N Svs1 n/a
3 TRCN0000120036 CAGTACTTTAACTCCAACTTT pLKO.1 1796 CDS 100% 5.625 3.938 N Svs1 n/a
4 TRCN0000120035 GCAACGCATTATGAATGACTA pLKO.1 823 CDS 100% 4.950 3.465 N Svs1 n/a
5 TRCN0000120032 GCCACTTTCTACAGCTCAGAA pLKO.1 1970 CDS 100% 4.950 2.970 N Svs1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172888.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.