Transcript: Mouse NM_172904.2

Mus musculus fibronectin type III and SPRY domain containing 2 (Fsd2), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Fsd2 (244091)
Length:
2976
CDS:
184..2334

Additional Resources:

NCBI RefSeq record:
NM_172904.2
NBCI Gene record:
Fsd2 (244091)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172904.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000246887 CGCCGAGCAAGACGCAATTTA pLKO_005 1880 CDS 100% 15.000 12.000 N Fsd2 n/a
2 TRCN0000217761 CGTGTATGCTGGAGCTTATAT pLKO.1 1255 CDS 100% 15.000 10.500 N Fsd2 n/a
3 TRCN0000257585 CGTGTATGCTGGAGCTTATAT pLKO_005 1255 CDS 100% 15.000 10.500 N Fsd2 n/a
4 TRCN0000246885 TTCCCGTAGGCTCACATATTT pLKO_005 2784 3UTR 100% 15.000 10.500 N Fsd2 n/a
5 TRCN0000246888 GCCGAAGATGACCGTGAATTA pLKO_005 334 CDS 100% 13.200 9.240 N Fsd2 n/a
6 TRCN0000246886 TTTAGGCCCTTCTGGTATTTC pLKO_005 2330 CDS 100% 13.200 9.240 N Fsd2 n/a
7 TRCN0000173903 GCTGAGCATTTGGACTACACT pLKO.1 1969 CDS 100% 3.000 2.100 N Fsd2 n/a
8 TRCN0000193267 CAATGGCATTTCAATGCCAAA pLKO.1 2295 CDS 100% 0.405 0.243 N Fsd2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172904.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.