Transcript: Mouse NM_172928.5

Mus musculus doublecortin-like kinase 3 (Dclk3), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Dclk3 (245038)
Length:
3498
CDS:
185..2557

Additional Resources:

NCBI RefSeq record:
NM_172928.5
NBCI Gene record:
Dclk3 (245038)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172928.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000024453 AGGAAGCTATAGCGCGGAAAT pLKO.1 865 CDS 100% 10.800 15.120 N Dclk3 n/a
2 TRCN0000368866 TATGTGGTGAGGCCTATATTT pLKO_005 2171 CDS 100% 15.000 10.500 N Dclk3 n/a
3 TRCN0000024450 CCAAAGATCTGGTGAGAAATT pLKO.1 2415 CDS 100% 13.200 9.240 N Dclk3 n/a
4 TRCN0000362339 GTGTGTGGGACGCCAACATAT pLKO_005 2195 CDS 100% 13.200 9.240 N Dclk3 n/a
5 TRCN0000362337 TGCAGAGCAGATGCCATAATC pLKO_005 2587 3UTR 100% 13.200 9.240 N Dclk3 n/a
6 TRCN0000024452 GTCCACATGCACGACAAGAAT pLKO.1 2054 CDS 100% 5.625 3.938 N Dclk3 n/a
7 TRCN0000024451 GTGGAGAAGCACTATGACATA pLKO.1 1712 CDS 100% 4.950 3.465 N Dclk3 n/a
8 TRCN0000024449 CTGAAGGGTAAGGAGGACATT pLKO.1 1832 CDS 100% 4.950 2.970 N Dclk3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172928.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.