Transcript: Mouse NM_172950.3

Mus musculus lipin 1 (Lpin1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Lpin1 (14245)
Length:
5482
CDS:
63..2738

Additional Resources:

NCBI RefSeq record:
NM_172950.3
NBCI Gene record:
Lpin1 (14245)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172950.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000098297 GCCGTGTCATATCAGCAATTT pLKO.1 1524 CDS 100% 13.200 18.480 N Lpin1 n/a
2 TRCN0000098299 GCCCAGTTGGACAATCTCAAA pLKO.1 546 CDS 100% 4.950 6.930 N Lpin1 n/a
3 TRCN0000305830 CTTGACGCGACCGAGCATTAA pLKO_005 2734 CDS 100% 13.200 9.240 N Lpin1 n/a
4 TRCN0000305768 AGTAAGGCCCAGACGGAAATG pLKO_005 1065 CDS 100% 10.800 7.560 N Lpin1 n/a
5 TRCN0000098298 CCAGTGTTTGACAGACATCAA pLKO.1 2396 CDS 100% 4.950 3.465 N Lpin1 n/a
6 TRCN0000324696 CCAGTGTTTGACAGACATCAA pLKO_005 2396 CDS 100% 4.950 3.465 N Lpin1 n/a
7 TRCN0000098296 CGCCAAAGAATAACCTGGAAA pLKO.1 856 CDS 100% 4.950 3.465 N Lpin1 n/a
8 TRCN0000305829 TGTGGAATTGGGACGACAAAG pLKO_005 2065 CDS 100% 10.800 6.480 N Lpin1 n/a
9 TRCN0000098295 GCTCTTTAATTGCTTTGGTTA pLKO.1 3310 3UTR 100% 4.950 2.970 N Lpin1 n/a
10 TRCN0000324634 GCTCTTTAATTGCTTTGGTTA pLKO_005 3310 3UTR 100% 4.950 2.970 N Lpin1 n/a
11 TRCN0000150763 GCAGAACTCTTCCTAATGATA pLKO.1 655 CDS 100% 5.625 3.938 N LPIN1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172950.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.