Transcript: Human NM_173054.2

Homo sapiens reelin (RELN), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
RELN (5649)
Length:
11565
CDS:
161..10537

Additional Resources:

NCBI RefSeq record:
NM_173054.2
NBCI Gene record:
RELN (5649)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_173054.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000051888 CCCAGCATCATCGTGTTATAT pLKO.1 998 CDS 100% 15.000 10.500 N RELN n/a
2 TRCN0000051890 CCAGGATACATGATGCAGTTT pLKO.1 9506 CDS 100% 4.950 3.465 N RELN n/a
3 TRCN0000051889 CCCAGAATAATCTCCGTAGAA pLKO.1 2621 CDS 100% 4.950 3.465 N RELN n/a
4 TRCN0000051892 GCACGGATGAAAGGAGTCTTA pLKO.1 10346 CDS 100% 4.950 3.465 N RELN n/a
5 TRCN0000051891 CCTCGGAAAGATTCCAGAATT pLKO.1 5313 CDS 100% 0.000 0.000 N RELN n/a
6 TRCN0000140715 GACAGCTCACAATCCAGGTTT pLKO.1 2447 CDS 100% 4.950 2.475 Y TMEM44 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_173054.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.