Transcript: Mouse NM_173068.2

Mus musculus synaptotagmin VII (Syt7), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-04-08
Taxon:
Mus musculus (mouse)
Gene:
Syt7 (54525)
Length:
6834
CDS:
394..2097

Additional Resources:

NCBI RefSeq record:
NM_173068.2
NBCI Gene record:
Syt7 (54525)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_173068.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000240858 AGTCTTTCGCCTTCGACATAC pLKO_005 1889 CDS 100% 10.800 15.120 N Syt7 n/a
2 TRCN0000240859 GTCAGCCTTAGCGTCACTATC pLKO_005 469 CDS 100% 10.800 15.120 N Syt7 n/a
3 TRCN0000240857 GGACACTGAGGATAGTATATA pLKO_005 2570 3UTR 100% 15.000 10.500 N Syt7 n/a
4 TRCN0000174338 CTGGAATGAGACCTTTCTATT pLKO.1 1482 CDS 100% 13.200 9.240 N Syt7 n/a
5 TRCN0000240860 GGTGAAGCGGAAGAATCTAAA pLKO_005 1455 CDS 100% 13.200 9.240 N Syt7 n/a
6 TRCN0000007970 ACTGGGCAAACGCTACAAGAA pLKO.1 525 CDS 100% 4.950 3.465 N SYT7 n/a
7 TRCN0000349644 ACTGGGCAAACGCTACAAGAA pLKO_005 525 CDS 100% 4.950 3.465 N SYT7 n/a
8 TRCN0000175581 CACGATCATCATCACTGTCAT pLKO.1 1932 CDS 100% 4.950 3.465 N Syt7 n/a
9 TRCN0000176047 GTTCAGTGTTGGCTACAACTT pLKO.1 1305 CDS 100% 4.950 3.465 N Syt7 n/a
10 TRCN0000173465 GCTACAACTTCCAAGAGTCCA pLKO.1 1316 CDS 100% 2.640 1.848 N Syt7 n/a
11 TRCN0000176121 GATGTATAAAGACAAGCGGGT pLKO.1 1815 CDS 100% 0.540 0.378 N Syt7 n/a
12 TRCN0000240861 TGAAGGTGTGGCTGATGTATA pLKO_005 1802 CDS 100% 13.200 7.920 N Syt7 n/a
13 TRCN0000175912 GACAAAGAAGAGGAACCTGAA pLKO.1 1854 CDS 100% 4.050 2.430 N Syt7 n/a
14 TRCN0000194143 GTGAGAAGAAAGCCATCAAGT pLKO.1 590 CDS 100% 4.950 3.465 N Syt7 n/a
15 TRCN0000178741 CACACACATACACACACACAA pLKO.1 14 5UTR 100% 4.950 2.475 Y Cstad n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_173068.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.