Transcript: Mouse NM_173069.3

Mus musculus spermatogenesis associated glutamate (E)-rich protein 2 (Speer2), mRNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
Speer2 (224318)
Length:
1121
CDS:
133..927

Additional Resources:

NCBI RefSeq record:
NM_173069.3
NBCI Gene record:
Speer2 (224318)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_173069.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000181954 GCTTGCCTGATCGCTTTCAAA pLKO.1 394 CDS 100% 5.625 4.500 N Speer2 n/a
2 TRCN0000177545 CAGAAGCTAAATCCGTTCTAT pLKO.1 448 CDS 100% 5.625 3.938 N Speer2 n/a
3 TRCN0000217149 CTATCTGATTCAGGGTGTTGT pLKO.1 947 3UTR 100% 4.950 3.465 N Speer2 n/a
4 TRCN0000181735 GCACCTGACCTAATCGAGAAT pLKO.1 301 CDS 100% 4.950 3.465 N Speer2 n/a
5 TRCN0000178541 GCACAAGTTACAGATGGAGAA pLKO.1 510 CDS 100% 4.050 2.835 N Speer2 n/a
6 TRCN0000181333 CGAACAAGAACAGACCAGCAA pLKO.1 723 CDS 100% 2.640 1.848 N Speer2 n/a
7 TRCN0000177486 GCAAGGAAGTACAGATTGATT pLKO.1 653 CDS 100% 5.625 3.375 N Speer2 n/a
8 TRCN0000198211 CCACAATCTACCTTGGATGAA pLKO.1 874 CDS 100% 4.950 2.970 N Speer2 n/a
9 TRCN0000198111 CTCCAGCAAGAGCTGAAATAT pLKO.1 776 CDS 100% 15.000 7.500 Y Speer2 n/a
10 TRCN0000195789 CAAGAGGAGATACAGGCTGTA pLKO.1 1034 3UTR 100% 4.050 2.025 Y Speer3 n/a
11 TRCN0000434795 AGCTCAAGAAGGAGATAAATT pLKO_005 557 CDS 100% 15.000 7.500 Y Speer4f1 n/a
12 TRCN0000257761 AGGGTGCTGATGGACAATAAT pLKO_005 1082 3UTR 100% 15.000 7.500 Y Speer3 n/a
13 TRCN0000249995 GAGCTCAAGAAGGAGATAAAT pLKO_005 556 CDS 100% 15.000 7.500 Y Speer4b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_173069.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.