Transcript: Human NM_173076.3

Homo sapiens ATP binding cassette subfamily A member 12 (ABCA12), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
ABCA12 (26154)
Length:
9298
CDS:
419..8206

Additional Resources:

NCBI RefSeq record:
NM_173076.3
NBCI Gene record:
ABCA12 (26154)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_173076.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000059445 CCCTGATAATAGAGCTGAGAT pLKO.1 2182 CDS 100% 4.950 6.930 N ABCA12 n/a
2 TRCN0000419455 CTTACTCATCCCAGGTAATTT pLKO_005 6021 CDS 100% 15.000 10.500 N ABCA12 n/a
3 TRCN0000059443 CCGAAGTATATGGGATGTTAT pLKO.1 4960 CDS 100% 13.200 9.240 N ABCA12 n/a
4 TRCN0000429217 GACTACAGCTTCTCGGTTATT pLKO_005 3875 CDS 100% 13.200 9.240 N ABCA12 n/a
5 TRCN0000059447 GCCAGCTTTGTCACCTATGTT pLKO.1 6422 CDS 100% 5.625 3.938 N ABCA12 n/a
6 TRCN0000059446 CCAACTTTATTGTCTCACAAA pLKO.1 7180 CDS 100% 4.950 3.465 N ABCA12 n/a
7 TRCN0000059444 GCCATTTCTTTGCCTGGCTTA pLKO.1 3744 CDS 100% 4.050 2.835 N ABCA12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_173076.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.