Transcript: Mouse NM_173350.3

Mus musculus oxysterol binding protein-like 9 (Osbpl9), transcript variant b, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Osbpl9 (100273)
Length:
3148
CDS:
116..2035

Additional Resources:

NCBI RefSeq record:
NM_173350.3
NBCI Gene record:
Osbpl9 (100273)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_173350.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000162447 CGAATGGTTCAGGTTGTGAAA pLKO.1 1109 CDS 100% 4.950 6.930 N OSBPL9 n/a
2 TRCN0000352912 CGAATGGTTCAGGTTGTGAAA pLKO_005 1109 CDS 100% 4.950 6.930 N OSBPL9 n/a
3 TRCN0000105014 GCTTAATAGATTCTTCTGGAT pLKO.1 753 CDS 100% 2.640 2.112 N Osbpl9 n/a
4 TRCN0000325932 GCTTAATAGATTCTTCTGGAT pLKO_005 753 CDS 100% 2.640 2.112 N Osbpl9 n/a
5 TRCN0000306134 CACCAAGAAATTGCCTATAAT pLKO_005 1753 CDS 100% 15.000 10.500 N Osbpl9 n/a
6 TRCN0000105010 CGACACAGATGAACAATTAAA pLKO.1 2166 3UTR 100% 15.000 10.500 N Osbpl9 n/a
7 TRCN0000325929 CGACACAGATGAACAATTAAA pLKO_005 2166 3UTR 100% 15.000 10.500 N Osbpl9 n/a
8 TRCN0000306135 TAATCCTGTAGATGCAATATA pLKO_005 415 CDS 100% 15.000 10.500 N Osbpl9 n/a
9 TRCN0000105013 CTTCCACACTAAGCCTTTCTA pLKO.1 1597 CDS 100% 5.625 3.938 N Osbpl9 n/a
10 TRCN0000325863 CTTCCACACTAAGCCTTTCTA pLKO_005 1597 CDS 100% 5.625 3.938 N Osbpl9 n/a
11 TRCN0000105012 CAATGCTCATATCTGGACTAA pLKO.1 1381 CDS 100% 4.950 3.465 N Osbpl9 n/a
12 TRCN0000162710 CCTTTGGAAGGATGTCACTTT pLKO.1 1825 CDS 100% 4.950 3.465 N OSBPL9 n/a
13 TRCN0000105011 GAATGGTATCATGTATGCAAA pLKO.1 1699 CDS 100% 4.950 3.465 N Osbpl9 n/a
14 TRCN0000165214 GCCTTTGGAAGGATGTCACTT pLKO.1 1824 CDS 100% 4.950 3.465 N OSBPL9 n/a
15 TRCN0000343431 GCCTTTGGAAGGATGTCACTT pLKO_005 1824 CDS 100% 4.950 3.465 N OSBPL9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_173350.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.