Transcript: Mouse NM_173364.5

Mus musculus zinc finger protein 445 (Zfp445), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Zfp445 (235682)
Length:
6189
CDS:
225..3185

Additional Resources:

NCBI RefSeq record:
NM_173364.5
NBCI Gene record:
Zfp445 (235682)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_173364.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000306599 TGTCAGGATGTAAGGTTAAAT pLKO_005 2895 CDS 100% 15.000 21.000 N Zfp445 n/a
2 TRCN0000095575 GCAATCTTTATCGGGATGTTA pLKO.1 946 CDS 100% 5.625 7.875 N Zfp445 n/a
3 TRCN0000095576 CGCAATCTTTATCGGGATGTT pLKO.1 945 CDS 100% 4.950 6.930 N Zfp445 n/a
4 TRCN0000332726 CGCAATCTTTATCGGGATGTT pLKO_005 945 CDS 100% 4.950 6.930 N Zfp445 n/a
5 TRCN0000095574 CCTTAGATAATTCTTGCTGTT pLKO.1 3454 3UTR 100% 4.050 5.670 N Zfp445 n/a
6 TRCN0000306600 CTGTTGGGAAGGGCCCATTTA pLKO_005 3517 3UTR 100% 13.200 10.560 N Zfp445 n/a
7 TRCN0000306601 GCAACCACAGTGGCGTGATAA pLKO_005 2771 CDS 100% 13.200 10.560 N Zfp445 n/a
8 TRCN0000095577 GCCTTTCACAATCGCTCATTT pLKO.1 2400 CDS 100% 13.200 9.240 N Zfp445 n/a
9 TRCN0000363549 GCCTTTCACAATCGCTCATTT pLKO_005 2400 CDS 100% 13.200 9.240 N Zfp445 n/a
10 TRCN0000095578 GCCTGTGTAAAGACATCAGTA pLKO.1 1176 CDS 100% 4.950 3.465 N Zfp445 n/a
11 TRCN0000375791 AGAGGAGGAGGATGGCTATAT pLKO_005 302 CDS 100% 13.200 7.920 N Zfp445 n/a
12 TRCN0000375864 GCATGTCTGTAGCCTAGTAAG pLKO_005 3490 3UTR 100% 10.800 6.480 N Zfp445 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_173364.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.