Transcript: Mouse NM_173367.3

Mus musculus cysteine-rich perinuclear theca 3 (Cypt3), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-25
Taxon:
Mus musculus (mouse)
Gene:
Cypt3 (69361)
Length:
672
CDS:
21..536

Additional Resources:

NCBI RefSeq record:
NM_173367.3
NBCI Gene record:
Cypt3 (69361)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_173367.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000197542 CTCGTAGCAGAATTACATTTA pLKO.1 268 CDS 100% 13.200 7.920 N Cypt3 n/a
2 TRCN0000177864 CGAATCAAGAGTGCTACTGAA pLKO.1 336 CDS 100% 4.950 2.970 N Cypt3 n/a
3 TRCN0000178336 GAGTGCTACTGAACTTCGATT pLKO.1 344 CDS 100% 4.950 2.970 N Cypt3 n/a
4 TRCN0000177906 CAAGTGAGATTACAGTGGCAT pLKO.1 418 CDS 100% 2.640 1.584 N Cypt3 n/a
5 TRCN0000427308 AGGAGAATTAGGAGACGAATC pLKO_005 321 CDS 100% 6.000 3.000 Y Cypt4 n/a
6 TRCN0000178304 GAAGCGAAACCCTAGATCTAA pLKO.1 140 CDS 100% 5.625 2.813 Y Cypt3 n/a
7 TRCN0000198386 GAGAATTAGGAGACGAATCAA pLKO.1 323 CDS 100% 5.625 2.813 Y Cypt4 n/a
8 TRCN0000181612 GATCTAAGCTTCCCAAGAGAT pLKO.1 154 CDS 100% 4.950 2.475 Y Cypt4 n/a
9 TRCN0000176461 CAAGCTTAATAAGAAGCGAAA pLKO.1 128 CDS 100% 4.050 2.025 Y Cypt3 n/a
10 TRCN0000441522 AGCCAACTGGAGCTGATCGAA pLKO_005 372 CDS 100% 3.000 1.500 Y Cypt1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_173367.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.