Transcript: Mouse NM_173371.4

Mus musculus hexose-6-phosphate dehydrogenase (glucose 1-dehydrogenase) (H6pd), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
H6pd (100198)
Length:
4746
CDS:
269..2662

Additional Resources:

NCBI RefSeq record:
NM_173371.4
NBCI Gene record:
H6pd (100198)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_173371.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000306056 GATGTACCGTGTGGATCATTA pLKO_005 877 CDS 100% 13.200 9.240 N H6pd n/a
2 TRCN0000306055 GCTATGTTCGGATTGTGTTTA pLKO_005 1383 CDS 100% 13.200 9.240 N H6pd n/a
3 TRCN0000041967 GCAGGGACTGTTTCAGCTATA pLKO.1 412 CDS 100% 10.800 7.560 N H6pd n/a
4 TRCN0000325836 GCAGGGACTGTTTCAGCTATA pLKO_005 412 CDS 100% 10.800 7.560 N H6pd n/a
5 TRCN0000041966 GCTGGTTTGGTACATGGATTA pLKO.1 2623 CDS 100% 10.800 7.560 N H6pd n/a
6 TRCN0000041963 GCCTAGAATGTCCCGTTCTTA pLKO.1 4328 3UTR 100% 5.625 3.938 N H6pd n/a
7 TRCN0000325904 GCCTAGAATGTCCCGTTCTTA pLKO_005 4328 3UTR 100% 5.625 3.938 N H6pd n/a
8 TRCN0000041965 CCAGCAGATTATCTTCTACAT pLKO.1 1468 CDS 100% 4.950 3.465 N H6pd n/a
9 TRCN0000325835 CCAGCAGATTATCTTCTACAT pLKO_005 1468 CDS 100% 4.950 3.465 N H6pd n/a
10 TRCN0000041964 GCCAGTTTCTATGAGGAGTAT pLKO.1 1034 CDS 100% 4.950 3.465 N H6pd n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_173371.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.