Transcript: Mouse NM_173385.2

Mus musculus cartilage intermediate layer protein, nucleotide pyrophosphohydrolase (Cilp), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Cilp (214425)
Length:
4153
CDS:
173..3925

Additional Resources:

NCBI RefSeq record:
NM_173385.2
NBCI Gene record:
Cilp (214425)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_173385.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000248564 CATGAGGATCCACGGGTTAAA pLKO_005 2762 CDS 100% 13.200 18.480 N Cilp n/a
2 TRCN0000355633 CATGAGGATCCACGGGTTAAA pLKO_005 2762 CDS 100% 13.200 18.480 N CILP n/a
3 TRCN0000248563 CTACCATCAATGCGGAGTTTG pLKO_005 1062 CDS 100% 10.800 8.640 N Cilp n/a
4 TRCN0000191525 GCCAGAACTGTTCCAATTATA pLKO.1 552 CDS 100% 15.000 10.500 N Cilp n/a
5 TRCN0000257568 ACAATGACACCAGCGAGTATA pLKO_005 3336 CDS 100% 13.200 9.240 N Cilp n/a
6 TRCN0000248565 CTGGATCCCTCCCTCTATAAG pLKO_005 1220 CDS 100% 13.200 9.240 N Cilp n/a
7 TRCN0000201332 GCCAGCCTTTACACTAATGAT pLKO.1 3995 3UTR 100% 5.625 3.938 N Cilp n/a
8 TRCN0000248562 GCCAGCCTTTACACTAATGAT pLKO_005 3995 3UTR 100% 5.625 3.938 N Cilp n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_173385.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.