Transcript: Mouse NM_173434.1

Mus musculus RIKEN cDNA 9930111J21 gene 2 (9930111J21Rik2), mRNA.

Source:
NCBI, updated 2017-04-25
Taxon:
Mus musculus (mouse)
Gene:
9930111J21Rik2 (245240)
Length:
2403
CDS:
268..1671

Additional Resources:

NCBI RefSeq record:
NM_173434.1
NBCI Gene record:
9930111J21Rik2 (245240)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_173434.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000102660 GCTTTGTATTTACGAAGTGTT pLKO.1 1725 3UTR 100% 4.950 6.930 N 9930111J21Rik2 n/a
2 TRCN0000102663 GCCTCTCTAGTGAGACTGTTA pLKO.1 1646 CDS 100% 4.950 3.960 N 9930111J21Rik2 n/a
3 TRCN0000102662 AGCAGATTCGACATACCATTT pLKO.1 893 CDS 100% 10.800 5.400 Y 9930111J21Rik2 n/a
4 TRCN0000102664 AGATTCGACATACCATTTCAA pLKO.1 896 CDS 100% 5.625 2.813 Y 9930111J21Rik2 n/a
5 TRCN0000102714 CCACATGATTATCTGAAGAAA pLKO.1 682 CDS 100% 5.625 2.813 Y Gm5431 n/a
6 TRCN0000102661 TCCTGATTTGACCTCCAGCTT pLKO.1 309 CDS 100% 2.640 1.320 Y 9930111J21Rik2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_173434.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.