Transcript: Human NM_173452.2

Homo sapiens ficolin 3 (FCN3), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
FCN3 (8547)
Length:
1046
CDS:
35..901

Additional Resources:

NCBI RefSeq record:
NM_173452.2
NBCI Gene record:
FCN3 (8547)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_173452.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000119227 GCATCCTGTTACCGATCAAAT pLKO.1 767 CDS 100% 13.200 18.480 N FCN3 n/a
2 TRCN0000119229 CTTTAATGGTAACCGTACTTT pLKO.1 556 CDS 100% 5.625 7.875 N FCN3 n/a
3 TRCN0000119230 CTGTGGATTTCTTCCGCTCTT pLKO.1 420 CDS 100% 4.050 5.670 N FCN3 n/a
4 TRCN0000119228 CCACGATTCAAGCAACAGCAA pLKO.1 712 CDS 100% 2.640 3.696 N FCN3 n/a
5 TRCN0000119231 CGCCCACAAATATGGCATTGA pLKO.1 820 CDS 100% 4.950 3.465 N FCN3 n/a
6 TRCN0000443982 GCTTACTCTCCAGGGTAACTG pLKO_005 511 CDS 100% 4.950 3.465 N FCN3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_173452.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.