Transcript: Human NM_173593.4

Homo sapiens beta-1,4-N-acetyl-galactosaminyltransferase 3 (B4GALNT3), mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
B4GALNT3 (283358)
Length:
5493
CDS:
439..3435

Additional Resources:

NCBI RefSeq record:
NM_173593.4
NBCI Gene record:
B4GALNT3 (283358)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_173593.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000413776 TGTGTTTGACCCGGTAGTAAA pLKO_005 2316 CDS 100% 13.200 18.480 N B4GALNT3 n/a
2 TRCN0000436396 GGGTACAGCAATTCATCAAAG pLKO_005 2837 CDS 100% 10.800 15.120 N B4GALNT3 n/a
3 TRCN0000035719 CGTGAAGCTAAGTGGAAACTT pLKO.1 2982 CDS 100% 5.625 7.875 N B4GALNT3 n/a
4 TRCN0000035723 CCCACACTTCAACATCGTCAT pLKO.1 2889 CDS 100% 4.050 5.670 N B4GALNT3 n/a
5 TRCN0000035722 CCACATGGAGACCCACAATAA pLKO.1 1590 CDS 100% 13.200 9.240 N B4GALNT3 n/a
6 TRCN0000035721 CCAGCCAAGATTCACCTCATT pLKO.1 2003 CDS 100% 4.950 3.465 N B4GALNT3 n/a
7 TRCN0000035720 CCGGTTTGTTCATCTGTCTTT pLKO.1 1539 CDS 100% 4.950 3.465 N B4GALNT3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_173593.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.