Transcript: Human NM_173611.4

Homo sapiens family with sequence similarity 98 member B (FAM98B), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
FAM98B (283742)
Length:
4388
CDS:
36..1337

Additional Resources:

NCBI RefSeq record:
NM_173611.4
NBCI Gene record:
FAM98B (283742)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_173611.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000417603 GACCGCATGTGCCATTAATAA pLKO_005 911 CDS 100% 15.000 21.000 N FAM98B n/a
2 TRCN0000416110 GTGGATATAGAAGATACTAAA pLKO_005 1318 CDS 100% 13.200 18.480 N FAM98B n/a
3 TRCN0000168833 CGCCGACGAATGTTAATGAAA pLKO.1 696 CDS 100% 5.625 7.875 N FAM98B n/a
4 TRCN0000134005 CAAGTCAACAACTTCTGACAT pLKO.1 515 CDS 100% 4.950 6.930 N FAM98B n/a
5 TRCN0000427821 TCCATATTCTGTACTCATATC pLKO_005 314 CDS 100% 10.800 7.560 N FAM98B n/a
6 TRCN0000190520 GAGAGCTTCCAGCTTGAGATA pLKO.1 267 CDS 100% 4.950 3.465 N Fam98b n/a
7 TRCN0000134790 CCAAGATCATTAGGACAAGTA pLKO.1 871 CDS 100% 4.950 2.970 N FAM98B n/a
8 TRCN0000428035 AGTACAGAACTTCAAGCTTTA pLKO_005 396 CDS 100% 10.800 7.560 N Fam98b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_173611.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.