Transcript: Mouse NM_173863.2

Mus musculus CREB regulated transcription coactivator 3 (Crtc3), mRNA.

Source:
NCBI, updated 2017-06-25
Taxon:
Mus musculus (mouse)
Gene:
Crtc3 (70461)
Length:
5110
CDS:
140..1999

Additional Resources:

NCBI RefSeq record:
NM_173863.2
NBCI Gene record:
Crtc3 (70461)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_173863.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000241210 GACAATGTAGCACTGAATTAA pLKO_005 4474 3UTR 100% 15.000 10.500 N Crtc3 n/a
2 TRCN0000241213 CCTTCTCACACAGTAAGTAAT pLKO_005 3616 3UTR 100% 13.200 9.240 N Crtc3 n/a
3 TRCN0000241214 TATTCATGCTCGTGCACATAT pLKO_005 4857 3UTR 100% 13.200 9.240 N Crtc3 n/a
4 TRCN0000241211 TTTCATGTGTGTAGCTTTAAG pLKO_005 4524 3UTR 100% 13.200 9.240 N Crtc3 n/a
5 TRCN0000241212 TGTTGGGCTCTTCTGATTTAT pLKO_005 4892 3UTR 100% 15.000 9.000 N Crtc3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_173863.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.