Transcript: Mouse NM_174847.2

Mus musculus C2 calcium-dependent domain containing 2 (C2cd2), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
C2cd2 (207781)
Length:
6568
CDS:
319..2409

Additional Resources:

NCBI RefSeq record:
NM_174847.2
NBCI Gene record:
C2cd2 (207781)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_174847.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000263412 CCATTCACCTGGACCTATTTA pLKO_005 1340 CDS 100% 15.000 21.000 N C2cd2 n/a
2 TRCN0000263410 TCACATAATGACCTGGTATTC pLKO_005 2263 CDS 100% 10.800 15.120 N C2cd2 n/a
3 TRCN0000263411 CCGTCACAGTGAAGGTCATTG pLKO_005 1640 CDS 100% 10.800 7.560 N C2cd2 n/a
4 TRCN0000263409 GTCCAGTTTGCTACCAGATAC pLKO_005 2602 3UTR 100% 10.800 7.560 N C2cd2 n/a
5 TRCN0000179284 GCTTGTCTATCTTGGTTGTTT pLKO.1 2498 3UTR 100% 5.625 3.938 N C2cd2 n/a
6 TRCN0000195938 CCAGTCACATAATGACCTGGT pLKO.1 2259 CDS 100% 2.160 1.512 N C2cd2 n/a
7 TRCN0000282612 GAGCTATGAAGAAGCATAAAG pLKO_005 2168 CDS 100% 13.200 7.920 N C2cd2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_174847.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.