Transcript: Mouse NM_174868.4

Mus musculus mitoguardin 1 (Miga1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Miga1 (215708)
Length:
5355
CDS:
377..2179

Additional Resources:

NCBI RefSeq record:
NM_174868.4
NBCI Gene record:
Miga1 (215708)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_174868.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000178542 GCACGGAAGAATCCAAAGAAA pLKO.1 1547 CDS 100% 5.625 7.875 N Miga1 n/a
2 TRCN0000215729 CTATGTTCTTGTTCAACTAAA pLKO.1 4442 3UTR 100% 13.200 10.560 N Miga1 n/a
3 TRCN0000177183 GAATTATTTGAAGAGGCGTTA pLKO.1 923 CDS 100% 4.050 3.240 N Miga1 n/a
4 TRCN0000197385 CTGATGGGTATGGAATTATTT pLKO.1 911 CDS 100% 15.000 10.500 N Miga1 n/a
5 TRCN0000215524 GAAAGTGTGGATGATATTATT pLKO.1 1040 CDS 100% 15.000 10.500 N Miga1 n/a
6 TRCN0000216740 GAATCTGACCTTGTCGTTAAG pLKO.1 679 CDS 100% 10.800 7.560 N Miga1 n/a
7 TRCN0000197967 GCTTGTCTGTTTGCTAATGTA pLKO.1 2661 3UTR 100% 5.625 3.938 N Miga1 n/a
8 TRCN0000176735 CCATTGCAAATGATACTGATA pLKO.1 1158 CDS 100% 4.950 3.465 N Miga1 n/a
9 TRCN0000198605 CCAAGGAGAAAGGATCTCAGT pLKO.1 705 CDS 100% 2.640 1.848 N Miga1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_174868.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.