Transcript: Human NM_174899.5

Homo sapiens F-box protein 36 (FBXO36), mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
FBXO36 (130888)
Length:
2813
CDS:
12..578

Additional Resources:

NCBI RefSeq record:
NM_174899.5
NBCI Gene record:
FBXO36 (130888)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_174899.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416838 GAACGGCTCTCAGACGATTTG pLKO_005 294 CDS 100% 10.800 15.120 N FBXO36 n/a
2 TRCN0000158205 CAGACGATTTGCTCCTGACTA pLKO.1 304 CDS 100% 4.950 6.930 N FBXO36 n/a
3 TRCN0000158043 CTTGCTAGAGTCACCGTCATT pLKO.1 751 3UTR 100% 4.950 6.930 N FBXO36 n/a
4 TRCN0000153589 GCTGTGCATGTCTGATAAACT pLKO.1 389 CDS 100% 5.625 4.500 N FBXO36 n/a
5 TRCN0000152040 CAAGGTCAAACTGCCTTAATA pLKO.1 213 CDS 100% 15.000 10.500 N FBXO36 n/a
6 TRCN0000426686 GTTGATGCGTGGAGCCATTTG pLKO_005 678 3UTR 100% 10.800 7.560 N FBXO36 n/a
7 TRCN0000153293 GAAACCCATGAAGACTTCCTA pLKO.1 177 CDS 100% 3.000 2.100 N FBXO36 n/a
8 TRCN0000153734 CCAAATCTCTTCTGTCTCCTT pLKO.1 635 3UTR 100% 2.640 1.848 N FBXO36 n/a
9 TRCN0000153776 CTTGAAGATATTGCCAGGCTT pLKO.1 342 CDS 100% 2.640 1.848 N FBXO36 n/a
10 TRCN0000165027 GAACTCCTGACCTCAAGTGAT pLKO.1 1363 3UTR 100% 4.950 2.475 Y LOC387873 n/a
11 TRCN0000162795 CTTCCAAAGTGCTGGGATTAT pLKO.1 1397 3UTR 100% 13.200 6.600 Y SLC48A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_174899.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.