Transcript: Human NM_174954.3

Homo sapiens ATPase sarcoplasmic/endoplasmic reticulum Ca2+ transporting 3 (ATP2A3), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-21
Taxon:
Homo sapiens (human)
Gene:
ATP2A3 (489)
Length:
4841
CDS:
147..3281

Additional Resources:

NCBI RefSeq record:
NM_174954.3
NBCI Gene record:
ATP2A3 (489)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_174954.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000038591 CGTGCTCGTGACCATTGAAAT pLKO.1 2852 CDS 100% 13.200 18.480 N ATP2A3 n/a
2 TRCN0000419499 GAGAACCTGCAGTCCTTTAAC pLKO_005 2211 CDS 100% 13.200 9.240 N ATP2A3 n/a
3 TRCN0000430941 CCAATATCACATCGGGCAAAG pLKO_005 781 CDS 100% 6.000 4.200 N ATP2A3 n/a
4 TRCN0000038593 CGCCTGTAACACGGTCATCAA pLKO.1 1553 CDS 100% 4.950 3.465 N ATP2A3 n/a
5 TRCN0000038590 CGCTGTCTACTACTTCAAGAT pLKO.1 1019 CDS 100% 4.950 3.465 N ATP2A3 n/a
6 TRCN0000436923 TCCCGGCTGTCATCACTACAT pLKO_005 1078 CDS 100% 4.950 3.465 N ATP2A3 n/a
7 TRCN0000038592 GACAAGAAGAACATGCTGTTT pLKO.1 753 CDS 100% 4.950 2.970 N ATP2A3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_174954.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.