Transcript: Mouse NM_175012.4

Mus musculus gastrin releasing peptide (Grp), mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Grp (225642)
Length:
905
CDS:
122..562

Additional Resources:

NCBI RefSeq record:
NM_175012.4
NBCI Gene record:
Grp (225642)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_175012.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000089063 CCGCAACTAAACTCGTGATTT pLKO.1 700 3UTR 100% 13.200 18.480 N Grp n/a
2 TRCN0000089064 GCTACTTTAACGACGTTCAAA pLKO.1 480 CDS 100% 5.625 7.875 N Grp n/a
3 TRCN0000089067 CGCTAAGTTGGTAGACTCTCT pLKO.1 502 CDS 100% 2.640 2.112 N Grp n/a
4 TRCN0000089065 GATTTGCTGGACCTCCTAGAA pLKO.1 380 CDS 100% 4.950 3.465 N Grp n/a
5 TRCN0000089066 TGTGGGACACTTAATGGGAAA pLKO.1 262 CDS 100% 4.050 2.835 N Grp n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175012.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.