Transcript: Mouse NM_175026.3

Mus musculus interferon activated gene 209 (Ifi209), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Ifi209 (236312)
Length:
3497
CDS:
318..1580

Additional Resources:

NCBI RefSeq record:
NM_175026.3
NBCI Gene record:
Ifi209 (236312)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_175026.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000095200 GCTATGAGATAGGAGATGATA pLKO.1 1396 CDS 100% 5.625 3.938 N Ifi209 n/a
2 TRCN0000095203 GCATCTAGTGTGTCAGAGGTA pLKO.1 1224 CDS 100% 2.640 1.848 N Ifi209 n/a
3 TRCN0000095202 TCCTCTAGCAACAATAGCCAA pLKO.1 935 CDS 100% 2.640 1.848 N Ifi209 n/a
4 TRCN0000218441 CAGGTTGCTCAGTTATCTTTA pLKO_005 714 CDS 100% 13.200 6.600 Y Ifi214 n/a
5 TRCN0000095201 CCATTCAAATTTCTCCAACAA pLKO.1 760 CDS 100% 4.950 2.475 Y Ifi209 n/a
6 TRCN0000095199 GCTTCCTTTATGAAACTGCAT pLKO.1 1600 3UTR 100% 2.640 1.320 Y Ifi209 n/a
7 TRCN0000166364 CACACACACACACACACACAA pLKO.1 116 5UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175026.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.