Transcript: Human NM_175038.2

Homo sapiens contactin 1 (CNTN1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-15
Taxon:
Homo sapiens (human)
Gene:
CNTN1 (1272)
Length:
5480
CDS:
77..3100

Additional Resources:

NCBI RefSeq record:
NM_175038.2
NBCI Gene record:
CNTN1 (1272)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_175038.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000073377 CCAAGGATCATCAGTTCAGTA pLKO.1 2768 CDS 100% 4.950 6.930 N CNTN1 n/a
2 TRCN0000289922 CCAAGGATCATCAGTTCAGTA pLKO_005 2768 CDS 100% 4.950 6.930 N CNTN1 n/a
3 TRCN0000073375 GCCGGAATGTATCAGTGCATA pLKO.1 1199 CDS 100% 4.950 6.930 N CNTN1 n/a
4 TRCN0000289847 GCCGGAATGTATCAGTGCATA pLKO_005 1199 CDS 100% 4.950 6.930 N CNTN1 n/a
5 TRCN0000073374 CCCGGTTTACAAATGGAGAAT pLKO.1 259 CDS 100% 4.950 3.960 N CNTN1 n/a
6 TRCN0000289921 CCCGGTTTACAAATGGAGAAT pLKO_005 259 CDS 100% 4.950 3.960 N CNTN1 n/a
7 TRCN0000073373 GCTCCATCCTAAGCCAAATAA pLKO.1 3187 3UTR 100% 15.000 10.500 N CNTN1 n/a
8 TRCN0000039015 GCAGCCAATCAATACCATTTA pLKO.1 178 CDS 100% 13.200 9.240 N Cntn1 n/a
9 TRCN0000222544 GCCGTGGTTCAGACAATCATA pLKO.1 1917 CDS 100% 5.625 3.938 N CNTN1 n/a
10 TRCN0000289920 GCCGTGGTTCAGACAATCATA pLKO_005 1917 CDS 100% 5.625 3.938 N CNTN1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175038.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.