Transcript: Mouse NM_175102.4

Mus musculus splicing factor 3b, subunit 5 (Sf3b5), mRNA.

Source:
NCBI, updated 2017-04-17
Taxon:
Mus musculus (mouse)
Gene:
Sf3b5 (66125)
Length:
750
CDS:
174..434

Additional Resources:

NCBI RefSeq record:
NM_175102.4
NBCI Gene record:
Sf3b5 (66125)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_175102.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000123725 CTCCTCAACTACTTCGCCATT pLKO.1 318 CDS 100% 4.050 3.240 N Sf3b5 n/a
2 TRCN0000298295 CTCCTCAACTACTTCGCCATT pLKO_005 318 CDS 100% 4.050 3.240 N Sf3b5 n/a
3 TRCN0000123728 CGACTCCTACTGCTCCTACAT pLKO.1 284 CDS 100% 4.950 3.465 N Sf3b5 n/a
4 TRCN0000298297 CGACTCCTACTGCTCCTACAT pLKO_005 284 CDS 100% 4.950 3.465 N Sf3b5 n/a
5 TRCN0000294702 GAGCATCTGCAGTCCAAGTAC pLKO_005 207 CDS 100% 4.950 3.465 N Sf3b5 n/a
6 TRCN0000123724 CTCCTTGTGAACTGTGCAGAA pLKO.1 578 3UTR 100% 4.050 2.835 N Sf3b5 n/a
7 TRCN0000287195 CTCCTTGTGAACTGTGCAGAA pLKO_005 578 3UTR 100% 4.050 2.835 N Sf3b5 n/a
8 TRCN0000307377 TGCGGTTCAACCTGATGGAGA pLKO_005 364 CDS 100% 2.640 1.848 N Sf3b5 n/a
9 TRCN0000123727 CGCGGACAAGCCCGAGGAGAA pLKO.1 410 CDS 100% 0.000 0.000 N Sf3b5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175102.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.