Transcript: Mouse NM_175106.3

Mus musculus transmembrane protein 177 (Tmem177), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Tmem177 (66343)
Length:
3302
CDS:
244..1179

Additional Resources:

NCBI RefSeq record:
NM_175106.3
NBCI Gene record:
Tmem177 (66343)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_175106.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000198222 CCGTCTTTGGAGTTAAACAAT pLKO.1 1288 3UTR 100% 5.625 7.875 N Tmem177 n/a
2 TRCN0000216567 GAACACTCTGTGATCATACAT pLKO.1 598 CDS 100% 5.625 4.500 N Tmem177 n/a
3 TRCN0000200450 GCCCTGACCATGTCTCATAAT pLKO.1 667 CDS 100% 13.200 9.240 N Tmem177 n/a
4 TRCN0000198029 CGTGATGAACTTGAGATGAAT pLKO.1 1224 3UTR 100% 5.625 3.938 N Tmem177 n/a
5 TRCN0000181461 CATGTCTCATAATGCCCAGAA pLKO.1 675 CDS 100% 4.050 2.835 N Tmem177 n/a
6 TRCN0000182311 GAACAAGCCTATTGGTGGGTT pLKO.1 290 CDS 100% 2.640 1.848 N Tmem177 n/a
7 TRCN0000200056 CCTCTTCCAAGAGGTGCTAAA pLKO.1 432 CDS 100% 1.080 0.756 N Tmem177 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175106.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.