Transcript: Mouse NM_175109.3

Mus musculus ribosomal protein S19 binding protein 1 (Rps19bp1), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Rps19bp1 (66538)
Length:
830
CDS:
29..460

Additional Resources:

NCBI RefSeq record:
NM_175109.3
NBCI Gene record:
Rps19bp1 (66538)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_175109.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000200194 CTTCTAGTTTGGCGGAACCAT pLKO.1 669 3UTR 100% 3.000 2.400 N Rps19bp1 n/a
2 TRCN0000200028 CCAGAAGTTCCAGAGGGAATA pLKO.1 427 CDS 100% 10.800 7.560 N Rps19bp1 n/a
3 TRCN0000200281 CCCTCAAACTGAAGTGGACTT pLKO.1 651 3UTR 100% 4.050 2.835 N Rps19bp1 n/a
4 TRCN0000181867 GTTTATGACCAGCATGAGAAG pLKO.1 265 CDS 100% 4.050 2.835 N Rps19bp1 n/a
5 TRCN0000197479 CAAAGCAAACCTGAAGTTTAT pLKO.1 250 CDS 100% 13.200 7.920 N Rps19bp1 n/a
6 TRCN0000177865 CAAGACGAAGAACAAGAAGAA pLKO.1 361 CDS 100% 4.950 2.970 N Rps19bp1 n/a
7 TRCN0000198840 CCTCAAAGCAAACCTGAAGTT pLKO.1 247 CDS 100% 4.950 2.970 N Rps19bp1 n/a
8 TRCN0000197737 GAACAAGAAGAAGAAGAAGAA pLKO.1 370 CDS 100% 4.950 2.970 N Rps19bp1 n/a
9 TRCN0000200356 GCTCTAGCTGAGTACCAGAAA pLKO.1 209 CDS 100% 4.950 2.970 N Rps19bp1 n/a
10 TRCN0000181254 CACTGAAGAAGACTTCCAGAA pLKO.1 412 CDS 100% 4.050 2.430 N Rps19bp1 n/a
11 TRCN0000181479 CCTGAAGTTTATGACCAGCAT pLKO.1 259 CDS 100% 2.640 1.584 N Rps19bp1 n/a
12 TRCN0000160007 CAAGAAGAAGAAGAAGAAGTA pLKO.1 373 CDS 100% 4.950 2.475 Y FAM98C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175109.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.