Transcript: Mouse NM_175138.4

Mus musculus dynein, axonemal, intermediate chain 1 (Dnaic1), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Dnaic1 (68922)
Length:
2508
CDS:
199..2304

Additional Resources:

NCBI RefSeq record:
NM_175138.4
NBCI Gene record:
Dnaic1 (68922)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_175138.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000115516 CGTGTTCTGAACCCAATACAA pLKO.1 2327 3UTR 100% 5.625 7.875 N Dnaic1 n/a
2 TRCN0000115518 CCACAAAGAGATCGACTACAT pLKO.1 1713 CDS 100% 4.950 3.960 N Dnaic1 n/a
3 TRCN0000115519 GAGGGCACATATAAACTTATT pLKO.1 439 CDS 100% 13.200 9.240 N Dnaic1 n/a
4 TRCN0000115517 GCTGGTTCACATCGACATTAT pLKO.1 1608 CDS 100% 13.200 9.240 N Dnaic1 n/a
5 TRCN0000115520 GAACTGATGAATGGTCCCAAT pLKO.1 290 CDS 100% 4.050 2.835 N Dnaic1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175138.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.